A multi-organ-chip co-culture of liver and testis equivalents: a first step toward a systemic male reprotoxicity model.

Is it possible to co-culture and functionally link human liver and testis equivalents in the combined medium circuit of a multi-organ chip?Multi-organ-chip co-cultures of human liver and testis equivalents were maintained at a steady-state for at least 1 week and the co-cultures reproduced specific natural and drug-induced liver-testis systemic interactions.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DLR-ADAMTS4-Ra-48T 48T
EUR 549
  • Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DLR-ADAMTS4-Ra-96T 96T
EUR 718
  • Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Hu-48Tests 48 Tests
EUR 521

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Hu-96Tests 96 Tests
EUR 723

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Ra-48Tests 48 Tests
EUR 557

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Ra-96Tests 96 Tests
EUR 775

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Hu-48Tests 48 Tests
EUR 544

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Hu-96Tests 96 Tests
EUR 756

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Ra-48Tests 48 Tests
EUR 583

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Ra-96Tests 96 Tests
EUR 811

Anti-ADAMTS4/ADAMTS4 Antibody

A02899 100ug/vial
EUR 334

Anti-ADAMTS4/ADAMTS4 Antibody

PA1479 100ug/vial
EUR 294

Adamts4/ Rat Adamts4 ELISA Kit

ELI-05836r 96 Tests
EUR 886

ADAMTS4 antibody

70R-2304 50 ug
EUR 467
Description: Rabbit polyclonal ADAMTS4 antibody raised against the N terminal of ADAMTS4

ADAMTS4 antibody

70R-14018 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal ADAMTS4 antibody

ADAMTS4 Antibody

32691-100ul 100ul
EUR 252

ADAMTS4 Antibody

1-CSB-PA001311LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ADAMTS4 Antibody

DF6986 200ul
EUR 304
Description: ADAMTS4 Antibody detects endogenous levels of total ADAMTS4.

ADAMTS4 siRNA

20-abx900171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 siRNA

20-abx906769
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 siRNA

20-abx906770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 Antibody

ABD6986 100 ug
EUR 438

anti-ADAMTS4

YF-PA16352 50 ul
EUR 363
Description: Mouse polyclonal to ADAMTS4

anti-ADAMTS4

YF-PA16353 100 ul
EUR 403
Description: Rabbit polyclonal to ADAMTS4

anti-ADAMTS4

YF-PA16354 100 ug
EUR 403
Description: Rabbit polyclonal to ADAMTS4

ADAMTS4 Blocking Peptide

33R-3654 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS4 antibody, catalog no. 70R-2304

ADAMTS4 Blocking Peptide

DF6986-BP 1mg
EUR 195

ADAMTS4 Conjugated Antibody

C32691 100ul
EUR 397

ADAMTS4 cloning plasmid

CSB-CL001311HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1020
  • Sequence: atgtcccagacaggctcgcatcccgggaggggcttggcagggcgctggctgtggggagcccaaccctgcctcctgctccccattgtgccgctctcctggctggtgtggctgcttctgctactgctggcctctctcctgccctcagcccggctggccagccccctcccccgggagg
  • Show more
Description: A cloning plasmid for the ADAMTS4 gene.

ADAMTS4 Polyclonal Antibody

A50013 100 µg
EUR 570.55
Description: fast delivery possible

ADAMTS4 Rabbit pAb

A2525-100ul 100 ul
EUR 308

ADAMTS4 Rabbit pAb

A2525-200ul 200 ul
EUR 459

ADAMTS4 Rabbit pAb

A2525-20ul 20 ul
EUR 183

ADAMTS4 Rabbit pAb

A2525-50ul 50 ul
EUR 223

ADAMTS4 Rabbit pAb

A15121-100ul 100 ul
EUR 308

ADAMTS4 Rabbit pAb

A15121-200ul 200 ul
EUR 459

ADAMTS4 Rabbit pAb

A15121-20ul 20 ul
EUR 183

ADAMTS4 Rabbit pAb

A15121-50ul 50 ul
EUR 223

Anti-ADAMTS4 antibody

STJ117315 100 µl
EUR 277
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 antibody

STJ22510 100 µl
EUR 277
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 (2A6)

YF-MA16887 100 ug
EUR 363
Description: Mouse monoclonal to ADAMTS4

ADAMTS4 Antibody, HRP conjugated

1-CSB-PA001311LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, FITC conjugated

1-CSB-PA001311LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, Biotin conjugated

1-CSB-PA001311LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal ADAMTS4 Antibody (Internal)

APR01979G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ADAMTS4 Antibody (Internal)

APR01980G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Human ADAMTS4 ELISA Kit

EHD0023 96Tests
EUR 521

Human ADAMTS4 ELISA Kit

ELA-E1804h 96 Tests
EUR 824

Goat ADAMTS4 ELISA Kit

EGTD0023 96Tests
EUR 521

Bovine ADAMTS4 ELISA Kit

EBD0023 96Tests
EUR 521

Canine ADAMTS4 ELISA Kit

ECD0023 96Tests
EUR 521

Anserini ADAMTS4 ELISA Kit

EAD0023 96Tests
EUR 521

Mouse Adamts4 ELISA KIT

ELI-05835m 96 Tests
EUR 865

Human ADAMTS4 ELISA KIT

ELI-05837h 96 Tests
EUR 824

Bovine ADAMTS4 ELISA KIT

ELI-05838b 96 Tests
EUR 928

Bovine ADAMTS4 ELISA KIT

ELI-06741b 96 Tests
EUR 928

ADAMTS4 ELISA KIT|Human

EF006049 96 Tests
EUR 689

Rat ADAMTS4 shRNA Plasmid

20-abx986451
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTS4 shRNA Plasmid

20-abx956314
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADAMTS4 shRNA Plasmid

20-abx982484
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADAMTS4 ELISA Kit

EMD0023 96Tests
EUR 521

Rat ADAMTS4 ELISA Kit

ERD0023 96Tests
EUR 521

Rabbit ADAMTS4 ELISA Kit

ERTD0023 96Tests
EUR 521

Porcine ADAMTS4 ELISA Kit

EPD0023 96Tests
EUR 521

Polyclonal ADAMTS4 Antibody (Metalloprotease Domain)

APR02063G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Metalloprotease Domain). This antibody is tested and proven to work in the following applications:

ELISA kit for Human ADAMTS4

EK5635 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAMTS4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ADAMTS4 PicoKine ELISA Kit

EK1372 96 wells
EUR 425
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig ADAMTS4 ELISA Kit

EGD0023 96Tests
EUR 521

ADAMTS4 Polyclonal Antibody, HRP Conjugated

A50014 100 µg
EUR 570.55
Description: reagents widely cited

ADAMTS4 Polyclonal Antibody, FITC Conjugated

A50015 100 µg
EUR 570.55
Description: Ask the seller for details

ADAMTS4 Polyclonal Antibody, Biotin Conjugated

A50016 100 µg
EUR 570.55
Description: The best epigenetics products

Adamts4 ORF Vector (Rat) (pORF)

ORF063070 1.0 ug DNA
EUR 506

ADAMTS4 ORF Vector (Human) (pORF)

ORF000180 1.0 ug DNA
EUR 95

Adamts4 ORF Vector (Mouse) (pORF)

ORF038112 1.0 ug DNA
EUR 506

ADAMTS4 ELISA Kit (Human) (OKAN04996)

OKAN04996 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL

ADAMTS4 ELISA Kit (Human) (OKBB00627)

OKBB00627 96 Wells
EUR 505
Description: Description of target: ADAMTS4, A disintegrin and metalloproteinase with thrombospondin motifs 4 is an enzyme that in humans is encoded by the ADAMTS4 gene. ADAMTS4 is a member of the large ADAMTS family of zinc-dependent proteases. The human ADAMTS4 gene is mapped to chromosome 1 by somatic cell hybrid analysis. The enzyme encoded by this gene lacks a C-terminal TS motif. It is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The cleavage of aggrecan and brevican suggests key roles of this enzyme in arthritic disease and in the central nervous system, potentially, in the progression of glioma.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

ADAMTS4 ELISA Kit (Human) (OKCD09242)

OKCD09242 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.115ng/mL

ADAMTS4 ELISA Kit (Rat) (OKCD09243)

OKCD09243 96 Wells
EUR 1053
Description: Description of target: Adamts4 is a disintegrin and metalloproteinase; Adamts4 may play a role in the progression of Alzheimers disease.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

ADAMTS4 ELISA Kit (Rabbit) (OKCD09244)

OKCD09244 96 Wells
EUR 1053
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Rabbit;Application: ELISA;Assay info: ;Sensitivity: < 12.1pg/mL

ADAMTS4 ELISA Kit (Mouse) (OKEH05322)

OKEH05322 96 Wells
EUR 662
Description: Description of target: Cleaves aggrecan, a cartilage proteoglycan, and may be involved in its turnover. May play an important role in the destruction of aggrecan in arthritic diseases. Cleaves aggrecan at the '392-Glu-|-Ala-393' site.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.335 ng/mL

ADAMTS4 ELISA Kit (Bovine) (OKEH08427)

OKEH08427 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ADAMTS4 ELISA Kit (Rat) (OKEH03412)

OKEH03412 96 Wells
EUR 662
Description: Description of target: Cleaves aggrecan, a cartilage proteoglycan, and may be involved in its turnover. May play an important role in the destruction of aggrecan in arthritic diseases. Cleaves aggrecan at the '392-Glu-|-Ala-393' site.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.4 pg/mL

Adamts4 sgRNA CRISPR Lentivector set (Mouse)

K4671601 3 x 1.0 ug
EUR 339

Adamts4 sgRNA CRISPR Lentivector set (Rat)

K6971301 3 x 1.0 ug
EUR 339

ADAMTS4 sgRNA CRISPR Lentivector set (Human)

K0043901 3 x 1.0 ug
EUR 339

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4671602 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4671603 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4671604 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6971302 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6971303 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6971304 1.0 ug DNA
EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0043902 1.0 ug DNA
EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0043903 1.0 ug DNA
EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0043904 1.0 ug DNA
EUR 154

ADAMTS4 Protein Vector (Mouse) (pPB-C-His)

PV152446 500 ng
EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPB-N-His)

PV152447 500 ng
EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPM-C-HA)

PV152448 500 ng
EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPM-C-His)

PV152449 500 ng
EUR 1065

Current benchtop reprotoxicity models typically do not include hepatic metabolism and interactions of the liver-testis axis. However, these are important to study the biotransformation of substances.

Testicular organoids derived from primary adult testicular cells and liver spheroids consisting of cultured HepaRG cells and hepatic stellatcells were loaded into separate culture compartments of each multi-organ-chip circuit for co-culture in liver spheroid-specific medium, testicular organoid-specific medium or a combined medium over a week.