A multi-organ-chip co-culture of liver and testis equivalents: a first step toward a systemic male reprotoxicity model.

Is it possible to co-culture and functionally link human liver and testis equivalents in the combined medium circuit of a multi-organ chip?Multi-organ-chip co-cultures of human liver and testis equivalents were maintained at a steady-state for at least 1 week and the co-cultures reproduced specific natural and drug-induced liver-testis systemic interactions.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
DLR-ADAMTS4-Ra-48T	DL Develop	48T	EUR 549
Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
DLR-ADAMTS4-Ra-96T	DL Develop	96T	EUR 718
Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RD-ADAMTS4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RD-ADAMTS4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RD-ADAMTS4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RD-ADAMTS4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RDR-ADAMTS4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RDR-ADAMTS4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RDR-ADAMTS4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
RDR-ADAMTS4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Anti-ADAMTS4/ADAMTS4 Antibody
A02899	BosterBio	100ug/vial	EUR 334

Anti-ADAMTS4/ADAMTS4 Antibody
PA1479	BosterBio	100ug/vial	EUR 294

Adamts4/ Rat Adamts4 ELISA Kit
ELI-05836r	Lifescience Market	96 Tests	EUR 886

ADAMTS4 siRNA
20-abx900171	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAMTS4 siRNA
20-abx906769	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAMTS4 siRNA
20-abx906770	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAMTS4 antibody
70R-2304	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ADAMTS4 antibody raised against the N terminal of ADAMTS4

ADAMTS4 Antibody
ABD6986	Lifescience Market	100 ug	EUR 438

ADAMTS4 Antibody
32691-100ul	SAB	100ul	EUR 252

ADAMTS4 antibody
70R-14018	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal ADAMTS4 antibody

ADAMTS4 Antibody
DF6986	Affbiotech	200ul	EUR 304
Description: ADAMTS4 Antibody detects endogenous levels of total ADAMTS4.

ADAMTS4 Antibody
1-CSB-PA001311LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

anti-ADAMTS4
YF-PA16352	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to ADAMTS4

anti-ADAMTS4
YF-PA16353	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to ADAMTS4

anti-ADAMTS4
YF-PA16354	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to ADAMTS4

ADAMTS4 Conjugated Antibody
C32691	SAB	100ul	EUR 397

ADAMTS4 Polyclonal Antibody
A50013	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

ADAMTS4 Rabbit pAb
A15121-100ul	Abclonal	100 ul	EUR 308

ADAMTS4 Rabbit pAb
A15121-200ul	Abclonal	200 ul	EUR 459

ADAMTS4 Rabbit pAb
A15121-20ul	Abclonal	20 ul	EUR 183

ADAMTS4 Rabbit pAb
A15121-50ul	Abclonal	50 ul	EUR 223

ADAMTS4 Rabbit pAb
A2525-100ul	Abclonal	100 ul	EUR 308

ADAMTS4 Rabbit pAb
A2525-200ul	Abclonal	200 ul	EUR 459

ADAMTS4 Rabbit pAb
A2525-20ul	Abclonal	20 ul	EUR 183

ADAMTS4 Rabbit pAb
A2525-50ul	Abclonal	50 ul	EUR 223

ADAMTS4 Blocking Peptide
33R-3654	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS4 antibody, catalog no. 70R-2304

ADAMTS4 Blocking Peptide
DF6986-BP	Affbiotech	1mg	EUR 195

ADAMTS4 cloning plasmid
CSB-CL001311HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1020 Sequence: atgtcccagacaggctcgcatcccgggaggggcttggcagggcgctggctgtggggagcccaaccctgcctcctgctccccattgtgccgctctcctggctggtgtggctgcttctgctactgctggcctctctcctgccctcagcccggctggccagccccctcccccgggagg Show more
Description: A cloning plasmid for the ADAMTS4 gene.

Anti-ADAMTS4 antibody
STJ22510	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 antibody
STJ117315	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 (2A6)
YF-MA16887	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ADAMTS4

Polyclonal ADAMTS4 Antibody (Internal)
APR01979G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ADAMTS4 Antibody (Internal)
APR01980G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Rat ADAMTS4 shRNA Plasmid
20-abx986451	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ADAMTS4 ELISA Kit
EHD0023	Abclonal	96Tests	EUR 521

Human ADAMTS4 ELISA Kit
ELA-E1804h	Lifescience Market	96 Tests	EUR 824

Goat ADAMTS4 ELISA Kit
EGTD0023	Abclonal	96Tests	EUR 521

Canine ADAMTS4 ELISA Kit
ECD0023	Abclonal	96Tests	EUR 521

Bovine ADAMTS4 ELISA Kit
EBD0023	Abclonal	96Tests	EUR 521

Anserini ADAMTS4 ELISA Kit
EAD0023	Abclonal	96Tests	EUR 521

Mouse Adamts4 ELISA KIT
ELI-05835m	Lifescience Market	96 Tests	EUR 865

Human ADAMTS4 ELISA KIT
ELI-05837h	Lifescience Market	96 Tests	EUR 824

Bovine ADAMTS4 ELISA KIT
ELI-05838b	Lifescience Market	96 Tests	EUR 928

Bovine ADAMTS4 ELISA KIT
ELI-06741b	Lifescience Market	96 Tests	EUR 928

ADAMTS4 ELISA KIT|Human
EF006049	Lifescience Market	96 Tests	EUR 689

Porcine ADAMTS4 ELISA Kit
EPD0023	Abclonal	96Tests	EUR 521

Rat ADAMTS4 ELISA Kit
ERD0023	Abclonal	96Tests	EUR 521

Rabbit ADAMTS4 ELISA Kit
ERTD0023	Abclonal	96Tests	EUR 521

Mouse ADAMTS4 ELISA Kit
EMD0023	Abclonal	96Tests	EUR 521

Human ADAMTS4 shRNA Plasmid
20-abx956314	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ADAMTS4 shRNA Plasmid
20-abx982484	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ADAMTS4 Antibody, HRP conjugated
1-CSB-PA001311LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, FITC conjugated
1-CSB-PA001311LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, Biotin conjugated
1-CSB-PA001311LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal ADAMTS4 Antibody (Metalloprotease Domain)
APR02063G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Metalloprotease Domain). This antibody is tested and proven to work in the following applications:

Human ADAMTS4 PicoKine ELISA Kit
EK1372	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human ADAMTS4
EK5635	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAMTS4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea Pig ADAMTS4 ELISA Kit
EGD0023	Abclonal	96Tests	EUR 521

ADAMTS4 Polyclonal Antibody, HRP Conjugated
A50014	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ADAMTS4 Polyclonal Antibody, FITC Conjugated
A50015	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ADAMTS4 Polyclonal Antibody, Biotin Conjugated
A50016	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ADAMTS4 ORF Vector (Human) (pORF)
ORF000180	ABM	1.0 ug DNA	EUR 95

Adamts4 ORF Vector (Mouse) (pORF)
ORF038112	ABM	1.0 ug DNA	EUR 506

Adamts4 ORF Vector (Rat) (pORF)
ORF063070	ABM	1.0 ug DNA	EUR 506

ADAMTS4 ELISA Kit (Human) (OKAN04996)
OKAN04996	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL

ADAMTS4 ELISA Kit (Human) (OKCD09242)
OKCD09242	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.115ng/mL

ADAMTS4 ELISA Kit (Rat) (OKCD09243)
OKCD09243	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: Adamts4 is a disintegrin and metalloproteinase; Adamts4 may play a role in the progression of Alzheimers disease.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

ADAMTS4 ELISA Kit (Rabbit) (OKCD09244)
OKCD09244	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Rabbit;Application: ELISA;Assay info: ;Sensitivity: < 12.1pg/mL

ADAMTS4 ELISA Kit (Rat) (OKEH03412)
OKEH03412	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Cleaves aggrecan, a cartilage proteoglycan, and may be involved in its turnover. May play an important role in the destruction of aggrecan in arthritic diseases. Cleaves aggrecan at the '392-Glu-|-Ala-393' site.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.4 pg/mL

ADAMTS4 ELISA Kit (Human) (OKBB00627)
OKBB00627	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: ADAMTS4, A disintegrin and metalloproteinase with thrombospondin motifs 4 is an enzyme that in humans is encoded by the ADAMTS4 gene. ADAMTS4 is a member of the large ADAMTS family of zinc-dependent proteases. The human ADAMTS4 gene is mapped to chromosome 1 by somatic cell hybrid analysis. The enzyme encoded by this gene lacks a C-terminal TS motif. It is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The cleavage of aggrecan and brevican suggests key roles of this enzyme in arthritic disease and in the central nervous system, potentially, in the progression of glioma.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

ADAMTS4 ELISA Kit (Mouse) (OKEH05322)
OKEH05322	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Cleaves aggrecan, a cartilage proteoglycan, and may be involved in its turnover. May play an important role in the destruction of aggrecan in arthritic diseases. Cleaves aggrecan at the '392-Glu-|-Ala-393' site.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.335 ng/mL

ADAMTS4 ELISA Kit (Bovine) (OKEH08427)
OKEH08427	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ADAMTS4 sgRNA CRISPR Lentivector set (Human)
K0043901	ABM	3 x 1.0 ug	EUR 339

Adamts4 sgRNA CRISPR Lentivector set (Mouse)
K4671601	ABM	3 x 1.0 ug	EUR 339

Adamts4 sgRNA CRISPR Lentivector set (Rat)
K6971301	ABM	3 x 1.0 ug	EUR 339

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0043902	ABM	1.0 ug DNA	EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0043903	ABM	1.0 ug DNA	EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0043904	ABM	1.0 ug DNA	EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4671602	ABM	1.0 ug DNA	EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4671603	ABM	1.0 ug DNA	EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4671604	ABM	1.0 ug DNA	EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6971302	ABM	1.0 ug DNA	EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6971303	ABM	1.0 ug DNA	EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6971304	ABM	1.0 ug DNA	EUR 154

ADAMTS4 Protein Vector (Human) (pPB-C-His)
PV000717	ABM	500 ng	EUR 329

ADAMTS4 Protein Vector (Human) (pPB-N-His)
PV000718	ABM	500 ng	EUR 329

ADAMTS4 Protein Vector (Human) (pPM-C-HA)
PV000719	ABM	500 ng	EUR 329

ADAMTS4 Protein Vector (Human) (pPM-C-His)
PV000720	ABM	500 ng	EUR 329

ADAMTS4 Protein Vector (Human) (pPB-His-MBP)
PV319886	ABM	500 ng	EUR 329

ADAMTS4 Protein Vector (Human) (pPB-His-GST)
PV319887	ABM	500 ng	EUR 329

ADAMTS4 Protein Vector (Mouse) (pPB-C-His)
PV152446	ABM	500 ng	EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPB-N-His)
PV152447	ABM	500 ng	EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPM-C-HA)
PV152448	ABM	500 ng	EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPM-C-His)
PV152449	ABM	500 ng	EUR 1065

ADAMTS4 Protein Vector (Rat) (pPB-C-His)
PV252278	ABM	500 ng	EUR 1166

ADAMTS4 Protein Vector (Rat) (pPB-N-His)
PV252279	ABM	500 ng	EUR 1166

ADAMTS4 Protein Vector (Rat) (pPM-C-HA)
PV252280	ABM	500 ng	EUR 1166

ADAMTS4 Protein Vector (Rat) (pPM-C-His)
PV252281	ABM	500 ng	EUR 1166

Adamts4 3'UTR Luciferase Stable Cell Line
TU200282	ABM	1.0 ml	Ask for price

Adamts4 3'UTR GFP Stable Cell Line
TU151398	ABM	1.0 ml	Ask for price

ADAMTS4 3'UTR Luciferase Stable Cell Line
TU000319	ABM	1.0 ml	EUR 1394

Adamts4 3'UTR Luciferase Stable Cell Line
TU101398	ABM	1.0 ml	Ask for price

ADAMTS4 3'UTR GFP Stable Cell Line
TU050319	ABM	1.0 ml	EUR 1394

Adamts4 3'UTR GFP Stable Cell Line
TU250282	ABM	1.0 ml	Ask for price

ADAMTS4 ELISA Kit (Human) : 96 Wells (OKEH02632)
OKEH02632	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV688237	ABM	1.0 ug DNA	EUR 1355

ADAMTS4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV688241	ABM	1.0 ug DNA	EUR 1355

ADAMTS4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV688242	ABM	1.0 ug DNA	EUR 1355

Adamts4 ELISA Kit| Rat A disintegrin and metalloproteinase with
EF017419	Lifescience Market	96 Tests	EUR 689

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody
20-abx171038	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody
20-abx104695	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody
20-abx175203	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Recombinant A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)
4-RPK204Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O75173 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.7kDa Isoelectric Point: 7.6
Description: Recombinant Human A Disintegrin And Metalloproteinase With Thrombospondin 4 expressed in: E.coli

ADAMTS4 Protein Vector (Human) (pPM-N-D-C-HA)
PV319888	ABM	500 ng	EUR 552

ADAMTS4 Protein Vector (Human) (pPM-N-D-C-His)
PV319889	ABM	500 ng	EUR 552

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein
20-abx652355	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein
20-abx652356	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human ADAM metallopeptidase with thrombospondin type 1 motif4(ADAMTS4)ELISAkit
GA-E1994HM-48T	GenAsia Biotech	48T	EUR 289

Human ADAM metallopeptidase with thrombospondin type 1 motif4(ADAMTS4)ELISAkit
GA-E1994HM-96T	GenAsia Biotech	96T	EUR 466

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0043905	ABM	3 x 1.0 ug	EUR 376

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein
20-abx065078	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody
20-abx001965	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody
abx038412-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody
20-abx104696	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (APC)
20-abx175204	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (APC)
20-abx175205	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (FITC)
20-abx273564	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody
20-abx318331	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (Biotin)
20-abx272433	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody
20-abx225013	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Human ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISAkit
201-12-1978	SunredBio	96 tests	EUR 440
This ADAM metallopeptidase with thrombospondin type 1 motif4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4671605	ABM	3 x 1.0 ug	EUR 376

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6971305	ABM	3 x 1.0 ug	EUR 376

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit
20-abx495833	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit
20-abx495834	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit
20-abx495835	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Porcine ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISA kit
GA-E0034PC-48T	GenAsia Biotech	48T	EUR 364

Porcine ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISA kit
GA-E0034PC-96T	GenAsia Biotech	96T	EUR 590

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0043906	ABM	1.0 ug DNA	EUR 167

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0043907	ABM	1.0 ug DNA	EUR 167

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0043908	ABM	1.0 ug DNA	EUR 167

Human ADAM with Thrombospondin Type 1 Motif 4 (ADAMTS4) CLIA Kit
abx195051-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (HRP)
20-abx303008	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (FITC)
20-abx303009	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (Biotin)
20-abx303010	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4671606	ABM	1.0 ug DNA	EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4671607	ABM	1.0 ug DNA	EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4671608	ABM	1.0 ug DNA	EUR 167

Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 ELISA Kit
CSB-E11848h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 in samples from serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 ELISA Kit
1-CSB-E11848h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 in samples from serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6971306	ABM	1.0 ug DNA	EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6971307	ABM	1.0 ug DNA	EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6971308	ABM	1.0 ug DNA	EUR 167

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV688238	ABM	1.0 ug DNA	EUR 1355

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV688239	ABM	1.0 ug DNA	EUR 1413

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV688240	ABM	1.0 ug DNA	EUR 1413

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Monoclonal Antibody (Human)
4-MAK204Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Thr437~Pro575 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Polyclonal Antibody (Human)
4-PAK204Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAMTS4 (Thr437~Pro575) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 ELISA Kit (ADAMTS4)
RK00818	Abclonal	96 Tests	EUR 521

Human A Disintegrin And Metalloproteinase With Thrombospondin 4(ADAMTS4)ELISA Kit
QY-E00631	Qayee Biotechnology	96T	EUR 361

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
4-SEK204Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as A Disintegrin And Metalloproteinase With Thrombospondin 4 elisa. Alternative names of the recognized antigen: ADMP-1 Aggrecanase-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
4-SEK204Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as A Disintegrin And Metalloproteinase With Thrombospondin 4 elisa. Alternative names of the recognized antigen: ADMP-1 Aggrecanase-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Rb-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Rb-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit
SEK204Rb-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Current benchtop reprotoxicity models typically do not include hepatic metabolism and interactions of the liver-testis axis. However, these are important to study the biotransformation of substances.

Testicular organoids derived from primary adult testicular cells and liver spheroids consisting of cultured HepaRG cells and hepatic stellate cells were loaded into separate culture compartments of each multi-organ-chip circuit for co-culture in liver spheroid-specific medium, testicular organoid-specific medium or a combined medium over a week.