A multi-organ-chip co-culture of liver and testis equivalents: a first step toward a systemic male reprotoxicity model.

Is it possible to co-culture and functionally link human liver and testis equivalents in the combined medium circuit of a multi-organ chip?Multi-organ-chip co-cultures of human liver and testis equivalents were maintained at a steady-state for at least 1 week and the co-cultures reproduced specific natural and drug-induced liver-testis systemic interactions.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

EUR 549
  • Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

EUR 718
  • Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Hu-48Tests 48 Tests
EUR 521

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Hu-96Tests 96 Tests
EUR 723

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Ra-48Tests 48 Tests
EUR 557

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Ra-96Tests 96 Tests
EUR 775

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Hu-48Tests 48 Tests
EUR 544

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Hu-96Tests 96 Tests
EUR 756

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Ra-48Tests 48 Tests
EUR 583

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Ra-96Tests 96 Tests
EUR 811

Anti-ADAMTS4/ADAMTS4 Antibody

A02899 100ug/vial
EUR 334

Anti-ADAMTS4/ADAMTS4 Antibody

PA1479 100ug/vial
EUR 294

Adamts4/ Rat Adamts4 ELISA Kit

ELI-05836r 96 Tests
EUR 886

ADAMTS4 antibody

70R-2304 50 ug
EUR 467
Description: Rabbit polyclonal ADAMTS4 antibody raised against the N terminal of ADAMTS4

ADAMTS4 antibody

70R-14018 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal ADAMTS4 antibody

ADAMTS4 Antibody

32691-100ul 100ul
EUR 252

ADAMTS4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ADAMTS4 Antibody

DF6986 200ul
EUR 304
Description: ADAMTS4 Antibody detects endogenous levels of total ADAMTS4.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 Antibody

ABD6986 100 ug
EUR 438


YF-PA16352 50 ul
EUR 363
Description: Mouse polyclonal to ADAMTS4


YF-PA16353 100 ul
EUR 403
Description: Rabbit polyclonal to ADAMTS4


YF-PA16354 100 ug
EUR 403
Description: Rabbit polyclonal to ADAMTS4

ADAMTS4 Blocking Peptide

33R-3654 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS4 antibody, catalog no. 70R-2304

ADAMTS4 Blocking Peptide

DF6986-BP 1mg
EUR 195

ADAMTS4 Conjugated Antibody

C32691 100ul
EUR 397

ADAMTS4 cloning plasmid

CSB-CL001311HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1020
  • Sequence: atgtcccagacaggctcgcatcccgggaggggcttggcagggcgctggctgtggggagcccaaccctgcctcctgctccccattgtgccgctctcctggctggtgtggctgcttctgctactgctggcctctctcctgccctcagcccggctggccagccccctcccccgggagg
  • Show more
Description: A cloning plasmid for the ADAMTS4 gene.

ADAMTS4 Polyclonal Antibody

A50013 100 µg
EUR 570.55
Description: fast delivery possible

ADAMTS4 Rabbit pAb

A2525-100ul 100 ul
EUR 308

ADAMTS4 Rabbit pAb

A2525-200ul 200 ul
EUR 459

ADAMTS4 Rabbit pAb

A2525-20ul 20 ul
EUR 183

ADAMTS4 Rabbit pAb

A2525-50ul 50 ul
EUR 223

ADAMTS4 Rabbit pAb

A15121-100ul 100 ul
EUR 308

ADAMTS4 Rabbit pAb

A15121-200ul 200 ul
EUR 459

ADAMTS4 Rabbit pAb

A15121-20ul 20 ul
EUR 183

ADAMTS4 Rabbit pAb

A15121-50ul 50 ul
EUR 223

Anti-ADAMTS4 antibody

STJ117315 100 µl
EUR 277
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 antibody

STJ22510 100 µl
EUR 277
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 (2A6)

YF-MA16887 100 ug
EUR 363
Description: Mouse monoclonal to ADAMTS4

ADAMTS4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal ADAMTS4 Antibody (Internal)

APR01979G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ADAMTS4 Antibody (Internal)

APR01980G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:


EHD0023 96Tests
EUR 521


ELA-E1804h 96 Tests
EUR 824


EGTD0023 96Tests
EUR 521


EBD0023 96Tests
EUR 521


ECD0023 96Tests
EUR 521

Anserini ADAMTS4 ELISA Kit

EAD0023 96Tests
EUR 521

Mouse Adamts4 ELISA KIT

ELI-05835m 96 Tests
EUR 865


ELI-05837h 96 Tests
EUR 824


ELI-05838b 96 Tests
EUR 928


ELI-06741b 96 Tests
EUR 928


EF006049 96 Tests
EUR 689

Rat ADAMTS4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTS4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADAMTS4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EMD0023 96Tests
EUR 521


ERD0023 96Tests
EUR 521


ERTD0023 96Tests
EUR 521


EPD0023 96Tests
EUR 521

Polyclonal ADAMTS4 Antibody (Metalloprotease Domain)

APR02063G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Metalloprotease Domain). This antibody is tested and proven to work in the following applications:

ELISA kit for Human ADAMTS4

EK5635 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAMTS4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ADAMTS4 PicoKine ELISA Kit

EK1372 96 wells
EUR 425
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig ADAMTS4 ELISA Kit

EGD0023 96Tests
EUR 521

ADAMTS4 Polyclonal Antibody, HRP Conjugated

A50014 100 µg
EUR 570.55
Description: reagents widely cited

ADAMTS4 Polyclonal Antibody, FITC Conjugated

A50015 100 µg
EUR 570.55
Description: Ask the seller for details

ADAMTS4 Polyclonal Antibody, Biotin Conjugated

A50016 100 µg
EUR 570.55
Description: The best epigenetics products

Adamts4 ORF Vector (Rat) (pORF)

ORF063070 1.0 ug DNA
EUR 506

ADAMTS4 ORF Vector (Human) (pORF)

ORF000180 1.0 ug DNA
EUR 95

Adamts4 ORF Vector (Mouse) (pORF)

ORF038112 1.0 ug DNA
EUR 506

ADAMTS4 ELISA Kit (Human) (OKAN04996)

OKAN04996 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL

ADAMTS4 ELISA Kit (Human) (OKBB00627)

OKBB00627 96 Wells
EUR 505
Description: Description of target: ADAMTS4, A disintegrin and metalloproteinase with thrombospondin motifs 4 is an enzyme that in humans is encoded by the ADAMTS4 gene. ADAMTS4 is a member of the large ADAMTS family of zinc-dependent proteases. The human ADAMTS4 gene is mapped to chromosome 1 by somatic cell hybrid analysis. The enzyme encoded by this gene lacks a C-terminal TS motif. It is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The cleavage of aggrecan and brevican suggests key roles of this enzyme in arthritic disease and in the central nervous system, potentially, in the progression of glioma.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

ADAMTS4 ELISA Kit (Human) (OKCD09242)

OKCD09242 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.115ng/mL

ADAMTS4 ELISA Kit (Rat) (OKCD09243)

OKCD09243 96 Wells
EUR 1053
Description: Description of target: Adamts4 is a disintegrin and metalloproteinase; Adamts4 may play a role in the progression of Alzheimers disease.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

ADAMTS4 ELISA Kit (Rabbit) (OKCD09244)

OKCD09244 96 Wells
EUR 1053
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Rabbit;Application: ELISA;Assay info: ;Sensitivity: < 12.1pg/mL

ADAMTS4 ELISA Kit (Mouse) (OKEH05322)

OKEH05322 96 Wells
EUR 662
Description: Description of target: Cleaves aggrecan, a cartilage proteoglycan, and may be involved in its turnover. May play an important role in the destruction of aggrecan in arthritic diseases. Cleaves aggrecan at the '392-Glu-|-Ala-393' site.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.335 ng/mL

ADAMTS4 ELISA Kit (Bovine) (OKEH08427)

OKEH08427 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ADAMTS4 ELISA Kit (Rat) (OKEH03412)

OKEH03412 96 Wells
EUR 662
Description: Description of target: Cleaves aggrecan, a cartilage proteoglycan, and may be involved in its turnover. May play an important role in the destruction of aggrecan in arthritic diseases. Cleaves aggrecan at the '392-Glu-|-Ala-393' site.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.4 pg/mL

Adamts4 sgRNA CRISPR Lentivector set (Mouse)

K4671601 3 x 1.0 ug
EUR 339

Adamts4 sgRNA CRISPR Lentivector set (Rat)

K6971301 3 x 1.0 ug
EUR 339

ADAMTS4 sgRNA CRISPR Lentivector set (Human)

K0043901 3 x 1.0 ug
EUR 339

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4671602 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4671603 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4671604 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6971302 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6971303 1.0 ug DNA
EUR 154

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6971304 1.0 ug DNA
EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0043902 1.0 ug DNA
EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0043903 1.0 ug DNA
EUR 154

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0043904 1.0 ug DNA
EUR 154

ADAMTS4 Protein Vector (Mouse) (pPB-C-His)

PV152446 500 ng
EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPB-N-His)

PV152447 500 ng
EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPM-C-HA)

PV152448 500 ng
EUR 1065

ADAMTS4 Protein Vector (Mouse) (pPM-C-His)

PV152449 500 ng
EUR 1065

ADAMTS4 Protein Vector (Rat) (pPB-C-His)

PV252278 500 ng
EUR 1166

ADAMTS4 Protein Vector (Rat) (pPB-N-His)

PV252279 500 ng
EUR 1166

ADAMTS4 Protein Vector (Rat) (pPM-C-HA)

PV252280 500 ng
EUR 1166

ADAMTS4 Protein Vector (Rat) (pPM-C-His)

PV252281 500 ng
EUR 1166

ADAMTS4 Protein Vector (Human) (pPB-His-MBP)

PV319886 500 ng
EUR 329

ADAMTS4 Protein Vector (Human) (pPB-His-GST)

PV319887 500 ng
EUR 329

ADAMTS4 Protein Vector (Human) (pPB-C-His)

PV000717 500 ng
EUR 329

ADAMTS4 Protein Vector (Human) (pPB-N-His)

PV000718 500 ng
EUR 329

ADAMTS4 Protein Vector (Human) (pPM-C-HA)

PV000719 500 ng
EUR 329

ADAMTS4 Protein Vector (Human) (pPM-C-His)

PV000720 500 ng
EUR 329

Adamts4 3'UTR Luciferase Stable Cell Line

TU101398 1.0 ml Ask for price

Adamts4 3'UTR GFP Stable Cell Line

TU151398 1.0 ml Ask for price

Adamts4 3'UTR Luciferase Stable Cell Line

TU200282 1.0 ml Ask for price

Adamts4 3'UTR GFP Stable Cell Line

TU250282 1.0 ml Ask for price

ADAMTS4 3'UTR GFP Stable Cell Line

TU050319 1.0 ml
EUR 1394

ADAMTS4 3'UTR Luciferase Stable Cell Line

TU000319 1.0 ml
EUR 1394

ADAMTS4 ELISA Kit (Human) : 96 Wells (OKEH02632)

OKEH02632 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV688237 1.0 ug DNA
EUR 1355

ADAMTS4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV688241 1.0 ug DNA
EUR 1355

ADAMTS4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV688242 1.0 ug DNA
EUR 1355

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adamts4 ELISA Kit| Rat A disintegrin and metalloproteinase with

EF017419 96 Tests
EUR 689

ADAMTS4 Protein Vector (Human) (pPM-N-D-C-HA)

PV319888 500 ng
EUR 552

ADAMTS4 Protein Vector (Human) (pPM-N-D-C-His)

PV319889 500 ng
EUR 552

Recombinant A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75173
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: 7.6
Description: Recombinant Human A Disintegrin And Metalloproteinase With Thrombospondin 4 expressed in: E.coli

Human ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISAkit

201-12-1978 96 tests
EUR 440
  • This ADAM metallopeptidase with thrombospondin type 1 motif4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

abx038412-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (APC)

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (APC)

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human ADAM metallopeptidase with thrombospondin type 1 motif4(ADAMTS4)ELISAkit

GA-E1994HM-48T 48T
EUR 289

Human ADAM metallopeptidase with thrombospondin type 1 motif4(ADAMTS4)ELISAkit

GA-E1994HM-96T 96T
EUR 466

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4671605 3 x 1.0 ug
EUR 376

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6971305 3 x 1.0 ug
EUR 376

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0043905 3 x 1.0 ug
EUR 376

Human ADAM with Thrombospondin Type 1 Motif 4 (ADAMTS4) CLIA Kit

abx195051-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 ELISA Kit

CSB-E11848h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 in samples from serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 in samples from serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Porcine ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISA kit

GA-E0034PC-48T 48T
EUR 364

Porcine ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISA kit

GA-E0034PC-96T 96T
EUR 590

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV688238 1.0 ug DNA
EUR 1355

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV688239 1.0 ug DNA
EUR 1413

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV688240 1.0 ug DNA
EUR 1413

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4671606 1.0 ug DNA
EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4671607 1.0 ug DNA
EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4671608 1.0 ug DNA
EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6971306 1.0 ug DNA
EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6971307 1.0 ug DNA
EUR 167

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6971308 1.0 ug DNA
EUR 167

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0043906 1.0 ug DNA
EUR 167

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0043907 1.0 ug DNA
EUR 167

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0043908 1.0 ug DNA
EUR 167

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Thr437~Pro575
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAMTS4 (Thr437~Pro575)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Human A Disintegrin And Metalloproteinase With Thrombospondin 4(ADAMTS4)ELISA Kit

QY-E00631 96T
EUR 361

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 ELISA Kit (ADAMTS4)

RK00818 96 Tests
EUR 521

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloproteinase With Thrombospondin 4 elisa. Alternative names of the recognized antigen: ADMP-1
  • Aggrecanase-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloproteinase With Thrombospondin 4 elisa. Alternative names of the recognized antigen: ADMP-1
  • Aggrecanase-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Rb-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Rb-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Rb-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Current benchtop reprotoxicity models typically do not include hepatic metabolism and interactions of the liver-testis axis. However, these are important to study the biotransformation of substances.

Testicular organoids derived from primary adult testicular cells and liver spheroids consisting of cultured HepaRG cells and hepatic stellatcells were loaded into separate culture compartments of each multi-organ-chip circuit for co-culture in liver spheroid-specific medium, testicular organoid-specific medium or a combined medium over a week.