A multi-organ-chip co-culture of liver and testis equivalents: a first step toward a systemic male reprotoxicity model.

Is it possible to co-culture and functionally link human liver and testis equivalents in the combined medium circuit of a multi-organ chip?Multi-organ-chip co-cultures of human liver and testis equivalents were maintained at a steady-state for at least 1 week and the co-cultures reproduced specific natural and drug-induced liver-testis systemic interactions.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DL-ADAMTS4-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DL-ADAMTS4-Ra-192 1 kit of 192 tests
EUR 1237.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DL-ADAMTS4-Ra-48 1 kit of 48 tests
EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DL-ADAMTS4-Ra-96 1 kit of 96 tests
EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DLR-ADAMTS4-Hu-48T 48T
EUR 517.00
  • Should the Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DLR-ADAMTS4-Hu-96T 96T
EUR 673.00
  • Should the Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DLR-ADAMTS4-Ra-48T 48T
EUR 549.00
  • Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

DLR-ADAMTS4-Ra-96T 96T
EUR 718.00
  • Should the Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Hu-48Tests 48 Tests
EUR 544.00

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Hu-96Tests 96 Tests
EUR 756.00

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Ra-48Tests 48 Tests
EUR 583.00

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RDR-ADAMTS4-Ra-96Tests 96 Tests
EUR 811.00

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Hu-48Tests 48 Tests
EUR 521.00

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Hu-96Tests 96 Tests
EUR 723.00

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Ra-48Tests 48 Tests
EUR 557.00

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

RD-ADAMTS4-Ra-96Tests 96 Tests
EUR 775.00

Anti-ADAMTS4/ADAMTS4 Antibody

A02899 100ug/vial
EUR 334.00

Anti-ADAMTS4/ADAMTS4 Antibody

PA1479 100ug/vial
EUR 294.00

Adamts4/ Rat Adamts4 ELISA Kit

ELI-05836r 96 Tests
EUR 886.00

ADAMTS4 Antibody

1-CSB-PA001311LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ADAMTS4 Antibody

32691-100ul 100ul
EUR 252.00

ADAMTS4 antibody

70R-2304 50 ug
EUR 467.00
Description: Rabbit polyclonal ADAMTS4 antibody raised against the N terminal of ADAMTS4

ADAMTS4 siRNA

20-abx900171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 siRNA

20-abx906769
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 siRNA

20-abx906770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS4 Antibody

DF6986 200ul
EUR 304.00
Description: ADAMTS4 Antibody detects endogenous levels of total ADAMTS4.

ADAMTS4 Antibody

ABD6986 100 ug
EUR 438.00

ADAMTS4 antibody

70R-14018 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal ADAMTS4 antibody

anti-ADAMTS4

YF-PA16352 50 ul
EUR 363.00
Description: Mouse polyclonal to ADAMTS4

anti-ADAMTS4

YF-PA16353 100 ul
EUR 403.00
Description: Rabbit polyclonal to ADAMTS4

anti-ADAMTS4

YF-PA16354 100 ug
EUR 403.00
Description: Rabbit polyclonal to ADAMTS4

ADAMTS4 Conjugated Antibody

C32691 100ul
EUR 397.00

ADAMTS4 cloning plasmid

CSB-CL001311HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1020
  • Sequence: atgtcccagacaggctcgcatcccgggaggggcttggcagggcgctggctgtggggagcccaaccctgcctcctgctccccattgtgccgctctcctggctggtgtggctgcttctgctactgctggcctctctcctgccctcagcccggctggccagccccctcccccgggagg
  • Show more
Description: A cloning plasmid for the ADAMTS4 gene.

ADAMTS4 Blocking Peptide

33R-3654 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS4 antibody, catalog no. 70R-2304

ADAMTS4 Polyclonal Antibody

A50013 100 µg
EUR 570.55
Description: fast delivery possible

ADAMTS4 Blocking Peptide

DF6986-BP 1mg
EUR 195.00

ADAMTS4 Rabbit pAb

A15121-100ul 100 ul
EUR 308.00

ADAMTS4 Rabbit pAb

A15121-200ul 200 ul
EUR 459.00

ADAMTS4 Rabbit pAb

A15121-20ul 20 ul
EUR 183.00

ADAMTS4 Rabbit pAb

A15121-50ul 50 ul
EUR 223.00

ADAMTS4 Rabbit pAb

A2525-100ul 100 ul
EUR 308.00

ADAMTS4 Rabbit pAb

A2525-200ul 200 ul
EUR 459.00

ADAMTS4 Rabbit pAb

A2525-20ul 20 ul
EUR 183.00

ADAMTS4 Rabbit pAb

A2525-50ul 50 ul
EUR 223.00

Anti-ADAMTS4 antibody

STJ22510 100 µl
EUR 277.00
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 antibody

STJ117315 100 µl
EUR 277.00
Description: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-ADAMTS4 (2A6)

YF-MA16887 100 ug
EUR 363.00
Description: Mouse monoclonal to ADAMTS4

Polyclonal ADAMTS4 Antibody (Internal)

APR01979G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ADAMTS4 Antibody (Internal)

APR01980G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Internal). This antibody is tested and proven to work in the following applications:

Mouse ADAMTS4 shRNA Plasmid

20-abx982484
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ADAMTS4 shRNA Plasmid

20-abx986451
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMTS4 Antibody, HRP conjugated

1-CSB-PA001311LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, FITC conjugated

1-CSB-PA001311LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS4 Antibody, Biotin conjugated

1-CSB-PA001311LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS4. Recognizes ADAMTS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ADAMTS4 shRNA Plasmid

20-abx956314
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ADAMTS4 ELISA Kit

ERD0023 96Tests
EUR 521.00

Rabbit ADAMTS4 ELISA Kit

ERTD0023 96Tests
EUR 521.00

Mouse ADAMTS4 ELISA Kit

EMD0023 96Tests
EUR 521.00

Porcine ADAMTS4 ELISA Kit

EPD0023 96Tests
EUR 521.00

Goat ADAMTS4 ELISA Kit

EGTD0023 96Tests
EUR 521.00

Anserini ADAMTS4 ELISA Kit

EAD0023 96Tests
EUR 521.00

Bovine ADAMTS4 ELISA Kit

EBD0023 96Tests
EUR 521.00

Human ADAMTS4 ELISA Kit

ELA-E1804h 96 Tests
EUR 824.00

Mouse Adamts4 ELISA KIT

ELI-05835m 96 Tests
EUR 865.00

Human ADAMTS4 ELISA KIT

ELI-05837h 96 Tests
EUR 824.00

Bovine ADAMTS4 ELISA KIT

ELI-05838b 96 Tests
EUR 928.00

Bovine ADAMTS4 ELISA KIT

ELI-06741b 96 Tests
EUR 928.00

Human ADAMTS4 ELISA Kit

EHD0023 96Tests
EUR 521.00

Canine ADAMTS4 ELISA Kit

ECD0023 96Tests
EUR 521.00

ADAMTS4 ELISA KIT|Human

EF006049 96 Tests
EUR 689.00

Polyclonal ADAMTS4 Antibody (Metalloprotease Domain)

APR02063G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS4 (Metalloprotease Domain). This antibody is tested and proven to work in the following applications:

ADAMTS4 Polyclonal Antibody, HRP Conjugated

A50014 100 µg
EUR 570.55
Description: reagents widely cited

ADAMTS4 Polyclonal Antibody, FITC Conjugated

A50015 100 µg
EUR 570.55
Description: Ask the seller for details

ADAMTS4 Polyclonal Antibody, Biotin Conjugated

A50016 100 µg
EUR 570.55
Description: The best epigenetics products

Human ADAMTS4 PicoKine ELISA Kit

EK1372 96 wells
EUR 425.00
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human ADAMTS4

EK5635 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAMTS4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea Pig ADAMTS4 ELISA Kit

EGD0023 96Tests
EUR 521.00

ADAMTS4 ORF Vector (Human) (pORF)

ORF000180 1.0 ug DNA
EUR 95.00

Adamts4 ORF Vector (Mouse) (pORF)

ORF038112 1.0 ug DNA
EUR 506.00

Adamts4 ORF Vector (Rat) (pORF)

ORF063070 1.0 ug DNA
EUR 506.00

ADAMTS4 sgRNA CRISPR Lentivector set (Human)

K0043901 3 x 1.0 ug
EUR 339.00

Adamts4 sgRNA CRISPR Lentivector set (Rat)

K6971301 3 x 1.0 ug
EUR 339.00

Adamts4 sgRNA CRISPR Lentivector set (Mouse)

K4671601 3 x 1.0 ug
EUR 339.00

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0043902 1.0 ug DNA
EUR 154.00

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0043903 1.0 ug DNA
EUR 154.00

ADAMTS4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0043904 1.0 ug DNA
EUR 154.00

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6971302 1.0 ug DNA
EUR 154.00

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6971303 1.0 ug DNA
EUR 154.00

Adamts4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6971304 1.0 ug DNA
EUR 154.00

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4671602 1.0 ug DNA
EUR 154.00

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4671603 1.0 ug DNA
EUR 154.00

Adamts4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4671604 1.0 ug DNA
EUR 154.00

ADAMTS4 Protein Vector (Human) (pPB-C-His)

PV000717 500 ng
EUR 329.00

ADAMTS4 Protein Vector (Human) (pPB-N-His)

PV000718 500 ng
EUR 329.00

ADAMTS4 Protein Vector (Human) (pPM-C-HA)

PV000719 500 ng
EUR 329.00

ADAMTS4 Protein Vector (Human) (pPM-C-His)

PV000720 500 ng
EUR 329.00

ADAMTS4 Protein Vector (Human) (pPB-His-MBP)

PV319886 500 ng
EUR 329.00

ADAMTS4 Protein Vector (Human) (pPB-His-GST)

PV319887 500 ng
EUR 329.00

ADAMTS4 Protein Vector (Rat) (pPB-C-His)

PV252278 500 ng
EUR 1166.00

ADAMTS4 Protein Vector (Rat) (pPB-N-His)

PV252279 500 ng
EUR 1166.00

ADAMTS4 Protein Vector (Rat) (pPM-C-HA)

PV252280 500 ng
EUR 1166.00

ADAMTS4 Protein Vector (Rat) (pPM-C-His)

PV252281 500 ng
EUR 1166.00

ADAMTS4 Protein Vector (Mouse) (pPB-C-His)

PV152446 500 ng
EUR 1065.00

ADAMTS4 Protein Vector (Mouse) (pPB-N-His)

PV152447 500 ng
EUR 1065.00

ADAMTS4 Protein Vector (Mouse) (pPM-C-HA)

PV152448 500 ng
EUR 1065.00

ADAMTS4 Protein Vector (Mouse) (pPM-C-His)

PV152449 500 ng
EUR 1065.00

ADAMTS4 3'UTR Luciferase Stable Cell Line

TU000319 1.0 ml
EUR 1394.00

Adamts4 3'UTR GFP Stable Cell Line

TU151398 1.0 ml Ask for price

ADAMTS4 3'UTR GFP Stable Cell Line

TU050319 1.0 ml
EUR 1394.00

Adamts4 3'UTR Luciferase Stable Cell Line

TU200282 1.0 ml Ask for price

Adamts4 3'UTR Luciferase Stable Cell Line

TU101398 1.0 ml Ask for price

Adamts4 3'UTR GFP Stable Cell Line

TU250282 1.0 ml Ask for price

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV688237 1.0 ug DNA
EUR 1355.00

ADAMTS4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV688241 1.0 ug DNA
EUR 1355.00

ADAMTS4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV688242 1.0 ug DNA
EUR 1355.00

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody

20-abx171038
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody

20-abx104695
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody

20-abx175203
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adamts4 ELISA Kit| Rat A disintegrin and metalloproteinase with

EF017419 96 Tests
EUR 689.00

ADAMTS4 Protein Vector (Human) (pPM-N-D-C-HA)

PV319888 500 ng
EUR 552.00

ADAMTS4 Protein Vector (Human) (pPM-N-D-C-His)

PV319889 500 ng
EUR 552.00

Recombinant A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

4-RPK204Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75173
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: 7.6
Description: Recombinant Human A Disintegrin And Metalloproteinase With Thrombospondin 4 expressed in: E.coli

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

20-abx104696
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein

20-abx065078
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISAkit

201-12-1978 96 tests
EUR 440.00
  • This ADAM metallopeptidase with thrombospondin type 1 motif4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

20-abx001965
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

abx038412-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein

20-abx652355
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Protein

20-abx652356
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

20-abx318331
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (Biotin)

20-abx272433
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (FITC)

20-abx273564
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (APC)

20-abx175204
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Antibody (APC)

20-abx175205
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody

20-abx225013
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0043905 3 x 1.0 ug
EUR 376.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6971305 3 x 1.0 ug
EUR 376.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4671605 3 x 1.0 ug
EUR 376.00

Human ADAM metallopeptidase with thrombospondin type 1 motif4(ADAMTS4)ELISAkit

GA-E1994HM-48T 48T
EUR 289.00

Human ADAM metallopeptidase with thrombospondin type 1 motif4(ADAMTS4)ELISAkit

GA-E1994HM-96T 96T
EUR 466.00

Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 ELISA Kit

CSB-E11848h-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 in samples from serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 ELISA Kit

1-CSB-E11848h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAM metallopeptidase with thrombospondin type 1 motif4, ADAMTS4 in samples from serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human ADAM with Thrombospondin Type 1 Motif 4 (ADAMTS4) CLIA Kit

abx195051-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit

20-abx495833
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit

20-abx495834
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) CLIA Kit

20-abx495835
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (HRP)

20-abx303008
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (FITC)

20-abx303009
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 (ADAMTS4) Antibody (Biotin)

20-abx303010
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ADAMTS4 (ADAM with Thrombospondin Type 1 Motif 4) CLIA Kit

E-CL-H0222-192 192 tests
EUR 995.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This CLIA kit uses the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS4 . Standards or samples are added to the micro CLIA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADAMTS4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADAMTS4 , biotinylated detection antibody and Avidin-HRP conjugate will appear fluorescence. The Relative light unit (RLU) value is measured by the Chemiluminescence immunoassay analyzer. The RLU value is positively associated with the concentration of Human ADAMTS4 . You can calculate the concentration of Human ADAMTS4 in the samples by comparing the RLU value of the samples to the standard curve.

Human ADAMTS4 (ADAM with Thrombospondin Type 1 Motif 4) CLIA Kit

E-CL-H0222-96 96 tests
EUR 582.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This CLIA kit uses the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS4 . Standards or samples are added to the micro CLIA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADAMTS4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADAMTS4 , biotinylated detection antibody and Avidin-HRP conjugate will appear fluorescence. The Relative light unit (RLU) value is measured by the Chemiluminescence immunoassay analyzer. The RLU value is positively associated with the concentration of Human ADAMTS4 . You can calculate the concentration of Human ADAMTS4 in the samples by comparing the RLU value of the samples to the standard curve.

Human ADAMTS4(ADAM with Thrombospondin Type 1 Motif 4) ELISA Kit

E-EL-H0266-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADAMTS4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADAMTS4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human ADAMTS4. You can calculate the concentration of Human ADAMTS4 in the samples by comparing the OD of the samples to the standard curve.

Human ADAMTS4(ADAM with Thrombospondin Type 1 Motif 4) ELISA Kit

E-EL-H0266-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADAMTS4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADAMTS4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human ADAMTS4. You can calculate the concentration of Human ADAMTS4 in the samples by comparing the OD of the samples to the standard curve.

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0043906 1.0 ug DNA
EUR 167.00

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0043907 1.0 ug DNA
EUR 167.00

ADAMTS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0043908 1.0 ug DNA
EUR 167.00

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Monoclonal Antibody (Human)

4-MAK204Hu21
  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Thr437~Pro575
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV688238 1.0 ug DNA
EUR 1355.00

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV688239 1.0 ug DNA
EUR 1413.00

ADAMTS4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV688240 1.0 ug DNA
EUR 1413.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6971306 1.0 ug DNA
EUR 167.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6971307 1.0 ug DNA
EUR 167.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6971308 1.0 ug DNA
EUR 167.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4671606 1.0 ug DNA
EUR 167.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4671607 1.0 ug DNA
EUR 167.00

Adamts4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4671608 1.0 ug DNA
EUR 167.00

Porcine ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISA kit

GA-E0034PC-48T 48T
EUR 364.00

Porcine ADAM metallopeptidase with thrombospondin type 1 motif4,ADAMTS4 ELISA kit

GA-E0034PC-96T 96T
EUR 590.00

Human A Disintegrin And Metalloproteinase With Thrombospondin 4(ADAMTS4)ELISA Kit

QY-E00631 96T
EUR 361.00

A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) Polyclonal Antibody (Human)

4-PAK204Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAMTS4 (Thr437~Pro575)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4)

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 ELISA Kit (ADAMTS4)

RK00818 96 Tests
EUR 521.00

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.30
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-1x96wellstestplate 1x96-wells test plate
EUR 639.00
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

4-SEK204Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloproteinase With Thrombospondin 4 elisa. Alternative names of the recognized antigen: ADMP-1
  • Aggrecanase-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.20
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.20
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.40
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in serum, plasma, tissue homogenates and other biological fluids.

Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

4-SEK204Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloproteinase With Thrombospondin 4 elisa. Alternative names of the recognized antigen: ADMP-1
  • Aggrecanase-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Rb-10x96wellstestplate 10x96-wells test plate
EUR 5124.20
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) ELISA Kit

SEK204Rb-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit A Disintegrin And Metalloproteinase With Thrombospondin 4 (ADAMTS4) in tissue homogenates, cell lysates and other biological fluids.

Current benchtop reprotoxicity models typically do not include hepatic metabolism and interactions of the liver-testis axis. However, these are important to study the biotransformation of substances.

Testicular organoids derived from primary adult testicular cells and liver spheroids consisting of cultured HepaRG cells and hepatic stellatcells were loaded into separate culture compartments of each multi-organ-chip circuit for co-culture in liver spheroid-specific medium, testicular organoid-specific medium or a combined medium over a week.

Scroll to Top